ID: 1142541170_1142541176

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1142541170 1142541176
Species Human (GRCh38) Human (GRCh38)
Location 17:660651-660673 17:660674-660696
Sequence CCCCTGGGTGCTGCTGGGTGTGG TGCATCCTTGGTGAAGGACGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 6, 3: 45, 4: 430} {0: 1, 1: 0, 2: 1, 3: 13, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!