ID: 1142541172_1142541175

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1142541172 1142541175
Species Human (GRCh38) Human (GRCh38)
Location 17:660652-660674 17:660668-660690
Sequence CCCTGGGTGCTGCTGGGTGTGGT GTGTGGTGCATCCTTGGTGAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 5, 3: 43, 4: 334} {0: 1, 1: 0, 2: 3, 3: 8, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!