ID: 1142541172_1142541180

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1142541172 1142541180
Species Human (GRCh38) Human (GRCh38)
Location 17:660652-660674 17:660683-660705
Sequence CCCTGGGTGCTGCTGGGTGTGGT GGTGAAGGACGAGGGCCCCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 5, 3: 43, 4: 334} {0: 1, 1: 1, 2: 4, 3: 11, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!