ID: 1142541178_1142541181

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1142541178 1142541181
Species Human (GRCh38) Human (GRCh38)
Location 17:660679-660701 17:660692-660714
Sequence CCTTGGTGAAGGACGAGGGCCCC CGAGGGCCCCTGGGTGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 131} {0: 2, 1: 0, 2: 4, 3: 34, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!