ID: 1142541178_1142541189

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1142541178 1142541189
Species Human (GRCh38) Human (GRCh38)
Location 17:660679-660701 17:660711-660733
Sequence CCTTGGTGAAGGACGAGGGCCCC CTGGGTGTGGTGCACCCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 131} {0: 3, 1: 0, 2: 4, 3: 26, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!