ID: 1142575984_1142575988

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1142575984 1142575988
Species Human (GRCh38) Human (GRCh38)
Location 17:908006-908028 17:908032-908054
Sequence CCCTCTCTAGAGACACCTGTGGT TTCAAAGGCATTCCTGCTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 166} {0: 1, 1: 0, 2: 0, 3: 12, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!