ID: 1142576543_1142576544

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1142576543 1142576544
Species Human (GRCh38) Human (GRCh38)
Location 17:912513-912535 17:912549-912571
Sequence CCAGTTTAATAATCACATATTTC CTTTAATTGCAAACAGAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 320} {0: 1, 1: 0, 2: 0, 3: 13, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!