ID: 1142580098_1142580106

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1142580098 1142580106
Species Human (GRCh38) Human (GRCh38)
Location 17:936622-936644 17:936663-936685
Sequence CCCAATTCTGGTTGTGCAAACAG CTACGATGTCTGGCTAAAACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115} {0: 1, 1: 0, 2: 0, 3: 5, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!