ID: 1142583979_1142583993

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1142583979 1142583993
Species Human (GRCh38) Human (GRCh38)
Location 17:959312-959334 17:959360-959382
Sequence CCCTCCCAGGCCCGCGACACTCC CGCGCAGAGGCTGCCTGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 207} {0: 1, 1: 0, 2: 0, 3: 23, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!