ID: 1142586717_1142586726

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1142586717 1142586726
Species Human (GRCh38) Human (GRCh38)
Location 17:979038-979060 17:979073-979095
Sequence CCAGGGCGGGCGCAGCGCAGCAC GGGGTCCTGGGATGAGGGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 202} {0: 1, 1: 0, 2: 7, 3: 120, 4: 875}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!