ID: 1142598043_1142598050

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1142598043 1142598050
Species Human (GRCh38) Human (GRCh38)
Location 17:1039174-1039196 17:1039195-1039217
Sequence CCGGCTTCTCTGCATGGTGCCCA CACCCTTCAGAGGCGGGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 355} {0: 1, 1: 0, 2: 0, 3: 7, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!