ID: 1142609739_1142609748

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1142609739 1142609748
Species Human (GRCh38) Human (GRCh38)
Location 17:1102266-1102288 17:1102286-1102308
Sequence CCCTGAGGCATCGTGGCCACAGA AGAAGGGGAGTGAGAGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 110} {0: 1, 1: 0, 2: 11, 3: 114, 4: 1000}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!