ID: 1142610951_1142610970

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1142610951 1142610970
Species Human (GRCh38) Human (GRCh38)
Location 17:1109059-1109081 17:1109109-1109131
Sequence CCTCCTCCATGGCAGCCGGAGCC CACGCAGCGGCGGCGGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 276} {0: 1, 1: 0, 2: 4, 3: 33, 4: 365}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!