ID: 1142618061_1142618066

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1142618061 1142618066
Species Human (GRCh38) Human (GRCh38)
Location 17:1148071-1148093 17:1148115-1148137
Sequence CCACGGTAAGCTTCAAGGATGGC AGTAAGCCCAAAGGTTGTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68} {0: 1, 1: 0, 2: 0, 3: 0, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!