ID: 1142619799_1142619801

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1142619799 1142619801
Species Human (GRCh38) Human (GRCh38)
Location 17:1157739-1157761 17:1157760-1157782
Sequence CCTGGTGGGATCAGCAGGACCAT ATGACCTGAGCCTGCCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 160} {0: 1, 1: 0, 2: 4, 3: 32, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!