ID: 1142629776_1142629779

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1142629776 1142629779
Species Human (GRCh38) Human (GRCh38)
Location 17:1217257-1217279 17:1217296-1217318
Sequence CCGTGACGCGTCTGTAATTGGAT TCTTGGATTATTCAAATTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 24} {0: 1, 1: 0, 2: 0, 3: 18, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!