ID: 1142631697_1142631720

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1142631697 1142631720
Species Human (GRCh38) Human (GRCh38)
Location 17:1229816-1229838 17:1229859-1229881
Sequence CCCGCCCCGGGCATCCCACAGCC CGGGGGAGGGCGGGAGCTGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 83, 4: 830}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!