ID: 1142637288_1142637291

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1142637288 1142637291
Species Human (GRCh38) Human (GRCh38)
Location 17:1265864-1265886 17:1265885-1265907
Sequence CCTCCCAAGTAGCTGGGACTACA CAGACGCCTGCCACAATGCCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!