ID: 1142637290_1142637298

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1142637290 1142637298
Species Human (GRCh38) Human (GRCh38)
Location 17:1265868-1265890 17:1265916-1265938
Sequence CCAAGTAGCTGGGACTACAGACG TTGTATGTTCAGTAAAGACGGGG
Strand - +
Off-target summary {0: 914, 1: 47477, 2: 116763, 3: 180045, 4: 133249} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!