ID: 1142637293_1142637298

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1142637293 1142637298
Species Human (GRCh38) Human (GRCh38)
Location 17:1265895-1265917 17:1265916-1265938
Sequence CCACAATGCCCGGCTAATTTTTT TTGTATGTTCAGTAAAGACGGGG
Strand - +
Off-target summary {0: 202, 1: 12584, 2: 80129, 3: 181089, 4: 210571} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!