ID: 1142652554_1142652562

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1142652554 1142652562
Species Human (GRCh38) Human (GRCh38)
Location 17:1364801-1364823 17:1364822-1364844
Sequence CCGTCCTACAGGTAACTCAAACT CTGTGGATAAGGGGGGATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 145} {0: 1, 1: 1, 2: 3, 3: 32, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!