|
Left Crispr |
Right Crispr |
| Crispr ID |
1142653379 |
1142653383 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:1372496-1372518
|
17:1372528-1372550
|
| Sequence |
CCTTCCTGACTCAGCTTCATCAT |
TTTATTTAAAGTGAGAGACTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 48, 3: 462, 4: 1074} |
{0: 1, 1: 1, 2: 23, 3: 106, 4: 963} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|