ID: 1142656872_1142656877

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1142656872 1142656877
Species Human (GRCh38) Human (GRCh38)
Location 17:1400192-1400214 17:1400223-1400245
Sequence CCGGGCAGCAAAAATGGCGGCGC GGGACTTCCGCCTGCGCACGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 79} {0: 1, 1: 1, 2: 0, 3: 3, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!