ID: 1142668696_1142668711

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1142668696 1142668711
Species Human (GRCh38) Human (GRCh38)
Location 17:1477448-1477470 17:1477500-1477522
Sequence CCGCAGGCTCTGCTGCAAGTGAG CTCACGTCAGGAAGTGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 295} {0: 1, 1: 0, 2: 0, 3: 5, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!