ID: 1142668702_1142668709

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1142668702 1142668709
Species Human (GRCh38) Human (GRCh38)
Location 17:1477480-1477502 17:1477496-1477518
Sequence CCAGCAGCCCCGCAGCCCCACTC CCCACTCACGTCAGGAAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 19, 3: 121, 4: 736} {0: 1, 1: 0, 2: 0, 3: 5, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!