ID: 1142668703_1142668712

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1142668703 1142668712
Species Human (GRCh38) Human (GRCh38)
Location 17:1477487-1477509 17:1477530-1477552
Sequence CCCCGCAGCCCCACTCACGTCAG CAGTATCCTCCAGCTTCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 171} {0: 1, 1: 0, 2: 2, 3: 26, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!