ID: 1142668710_1142668716

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1142668710 1142668716
Species Human (GRCh38) Human (GRCh38)
Location 17:1477497-1477519 17:1477539-1477561
Sequence CCACTCACGTCAGGAAGTGTGGA CCAGCTTCTCCAGGAAGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 69} {0: 1, 1: 0, 2: 0, 3: 48, 4: 545}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!