ID: 1142672944_1142672948

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1142672944 1142672948
Species Human (GRCh38) Human (GRCh38)
Location 17:1495796-1495818 17:1495812-1495834
Sequence CCGCCTGGGATTCACTCCCATCC CCCATCCTGGCTCAGATCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 293} {0: 1, 1: 0, 2: 1, 3: 17, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!