ID: 1142680994_1142681004

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1142680994 1142681004
Species Human (GRCh38) Human (GRCh38)
Location 17:1548576-1548598 17:1548619-1548641
Sequence CCACGACGTGCCCCACCAGCCAC AGACCCCAGGCTACCTGCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 156} {0: 1, 1: 0, 2: 4, 3: 22, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!