ID: 1142685064_1142685070

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1142685064 1142685070
Species Human (GRCh38) Human (GRCh38)
Location 17:1572784-1572806 17:1572815-1572837
Sequence CCTGAGGGTGGGTGGGAGAGTGA TGCCCACTTTGGCTGGGACTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 57, 4: 544} {0: 2, 1: 1, 2: 0, 3: 23, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!