ID: 1142687825_1142687834

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1142687825 1142687834
Species Human (GRCh38) Human (GRCh38)
Location 17:1587884-1587906 17:1587921-1587943
Sequence CCAGCCACAGCCTCTGTACCCTG CCTCAATCCCCAAGCACTGTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 51, 4: 505} {0: 2, 1: 0, 2: 0, 3: 19, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!