ID: 1142698940_1142698952

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1142698940 1142698952
Species Human (GRCh38) Human (GRCh38)
Location 17:1648244-1648266 17:1648292-1648314
Sequence CCTCCCAGTTCCCAGCGCAGGCC AATGACTGGAGAATGAGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 357} {0: 1, 1: 0, 2: 0, 3: 22, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!