ID: 1142698994_1142699005

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1142698994 1142699005
Species Human (GRCh38) Human (GRCh38)
Location 17:1648495-1648517 17:1648542-1648564
Sequence CCTTTGGAAGGACAGGCACAGTC CCCCGCCCCAGGGCCATCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 187} {0: 1, 1: 0, 2: 2, 3: 19, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!