ID: 1142699237_1142699245

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1142699237 1142699245
Species Human (GRCh38) Human (GRCh38)
Location 17:1649396-1649418 17:1649421-1649443
Sequence CCGGGGCTGCGCTTACCCTGTGG CCGCGCGCAGCTCCCTGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 202} {0: 1, 1: 0, 2: 1, 3: 13, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!