ID: 1142715590_1142715607

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1142715590 1142715607
Species Human (GRCh38) Human (GRCh38)
Location 17:1745373-1745395 17:1745409-1745431
Sequence CCCTCCTCAAGTTGGGCAACCAG GGGCTGGGGAAGAGTGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136} {0: 1, 1: 0, 2: 7, 3: 109, 4: 1049}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!