ID: 1142753279_1142753284

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1142753279 1142753284
Species Human (GRCh38) Human (GRCh38)
Location 17:2000897-2000919 17:2000928-2000950
Sequence CCCCTCTTGGAGGGATGGTGGGA TGGAAACAGCTGTGGCTCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 178} {0: 1, 1: 0, 2: 0, 3: 15, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!