ID: 1142763902_1142763924

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1142763902 1142763924
Species Human (GRCh38) Human (GRCh38)
Location 17:2055611-2055633 17:2055650-2055672
Sequence CCCGCCGGGACCGCAGGTAACGG GGCCAGGAGGGGAACGGGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 39} {0: 1, 1: 0, 2: 4, 3: 61, 4: 633}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!