ID: 1142764361_1142764369

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1142764361 1142764369
Species Human (GRCh38) Human (GRCh38)
Location 17:2057216-2057238 17:2057236-2057258
Sequence CCTCCGCCGCCGCCTGCCGCGGA GGAGCCGCCCTCGGGCCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 106, 4: 662} {0: 1, 1: 0, 2: 1, 3: 16, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!