ID: 1142799724_1142799734

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1142799724 1142799734
Species Human (GRCh38) Human (GRCh38)
Location 17:2337596-2337618 17:2337628-2337650
Sequence CCGCCTTGCGCGTGGGGCGCTGA CGCGGAGGCGGCGAGGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39} {0: 1, 1: 0, 2: 9, 3: 95, 4: 913}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!