ID: 1142799730_1142799737

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1142799730 1142799737
Species Human (GRCh38) Human (GRCh38)
Location 17:2337620-2337642 17:2337638-2337660
Sequence CCGAGAGGCGCGGAGGCGGCGAG GCGAGGGCGCGGGGGCTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126} {0: 1, 1: 0, 2: 3, 3: 44, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!