ID: 1142803069_1142803076

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1142803069 1142803076
Species Human (GRCh38) Human (GRCh38)
Location 17:2357061-2357083 17:2357098-2357120
Sequence CCAGCCGTGTGTAGCATTTGTTA ATGGCTTTGAGGTCACATCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 84} {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!