ID: 1142803069_1142803079

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1142803069 1142803079
Species Human (GRCh38) Human (GRCh38)
Location 17:2357061-2357083 17:2357109-2357131
Sequence CCAGCCGTGTGTAGCATTTGTTA GTCACATCGGGGCTGGTGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 84} {0: 1, 1: 0, 2: 1, 3: 4, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!