ID: 1142810497_1142810510

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1142810497 1142810510
Species Human (GRCh38) Human (GRCh38)
Location 17:2393582-2393604 17:2393629-2393651
Sequence CCGCAGCGTGGACGGGGACCACG CAGACATTCGGGCGGAATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 485} {0: 1, 1: 0, 2: 0, 3: 2, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!