ID: 1142812165_1142812174

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1142812165 1142812174
Species Human (GRCh38) Human (GRCh38)
Location 17:2400489-2400511 17:2400528-2400550
Sequence CCAGGCGGCGGCTCTCGCGGGGA CTCCGCAGGCCGCCCGGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 103} {0: 1, 1: 0, 2: 3, 3: 10, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!