ID: 1142815521_1142815527

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1142815521 1142815527
Species Human (GRCh38) Human (GRCh38)
Location 17:2422019-2422041 17:2422050-2422072
Sequence CCAATGGCACCTGCCGGGCGCGG GCTTGTAATCCTAGCACTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 75} {0: 14, 1: 1432, 2: 32520, 3: 264038, 4: 274153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!