ID: 1142815521_1142815528

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1142815521 1142815528
Species Human (GRCh38) Human (GRCh38)
Location 17:2422019-2422041 17:2422053-2422075
Sequence CCAATGGCACCTGCCGGGCGCGG TGTAATCCTAGCACTCTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 75} {0: 658, 1: 31076, 2: 324240, 3: 254433, 4: 137894}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!