ID: 1142815524_1142815530

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1142815524 1142815530
Species Human (GRCh38) Human (GRCh38)
Location 17:2422028-2422050 17:2422063-2422085
Sequence CCTGCCGGGCGCGGTGGCTCATG GCACTCTGGGAGGCCGAAGCAGG
Strand - +
Off-target summary {0: 186, 1: 1736, 2: 3930, 3: 6575, 4: 7131} {0: 92, 1: 5169, 2: 101945, 3: 237440, 4: 235241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!