|
Left Crispr |
Right Crispr |
Crispr ID |
1142815524 |
1142815530 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:2422028-2422050
|
17:2422063-2422085
|
Sequence |
CCTGCCGGGCGCGGTGGCTCATG |
GCACTCTGGGAGGCCGAAGCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 186, 1: 1736, 2: 3930, 3: 6575, 4: 7131} |
{0: 92, 1: 5169, 2: 101945, 3: 237440, 4: 235241} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|