|
Left Crispr |
Right Crispr |
Crispr ID |
1142815525 |
1142815528 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:2422032-2422054
|
17:2422053-2422075
|
Sequence |
CCGGGCGCGGTGGCTCATGCTTG |
TGTAATCCTAGCACTCTGGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 236, 1: 9036, 2: 60409, 3: 126173, 4: 167271} |
{0: 658, 1: 31076, 2: 324240, 3: 254433, 4: 137894} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|