ID: 1142841270_1142841277

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1142841270 1142841277
Species Human (GRCh38) Human (GRCh38)
Location 17:2632803-2632825 17:2632852-2632874
Sequence CCATTTTTTATCAGGGATATGAG GTCCTAGAACCATTGCCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 32, 3: 347, 4: 990} {0: 1, 1: 0, 2: 36, 3: 254, 4: 606}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!