|
Left Crispr |
Right Crispr |
| Crispr ID |
1142842342 |
1142842347 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:2643326-2643348
|
17:2643366-2643388
|
| Sequence |
CCAGGCAGGTCTCGAACTCCTGG |
GCCTCTGCCCCCCTAATAGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 179, 1: 10730, 2: 106343, 3: 213015, 4: 213534} |
{0: 1, 1: 9, 2: 624, 3: 18128, 4: 224695} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|